MRE-seq

From Dave's wiki
Jump to navigation Jump to search

The paper "Conserved role of intragenic DNA methylation in regulating alternative promoters" published by Maunakea et al., 2010 is cited for MRE-seq.

MRE is the abbreviation for methyl-sensitive restriction enzyme and these enzymes play a role in the analysis of methylated DNA; they are not able to cleave methylated-cytosine residues, leaving methylated DNA intact. MRE-seq involves sequencing size-selected (100-300 bp) fragments from parallel DNA digestions with these particular MREs: HapII, Hin6I, and AciI.

Restriction enzyme Recognition site Cut
HpaII 5' CCGG

3' GGCC

5' ---C CGG--- 3'

3' ---GGC C--- 5'

Hin6I 5' GCGC

3' CGCG

5' ---G CGC--- 3'

3' ---CGC G--- 5'

AciI 5' CCGC

3' GGCG

5' ---C CGC--- 3'

3' ---GGC G--- 5'

Supplementary Figure 1 from Maunakea et al. has a nice summary of MRE-seq and MeDIP-seq. From Figure S1, they show MRE-seq reads around the promoter of the PANX2 gene. Below I've obtained the genomic sequence of this region:

>hg19_dna range=chr22:50607707-50609778 5'pad=0 3'pad=0 strand=+ repeatMasking=none
CCTGGTTTGCTCACAGCAGTGGCCGGGCCTGTGAACACGGGCTCAAAATACATTTTTGGAATGAATTATTGAATGAACTTAAAACTCCAATCACACTAAA
TCTTTTATATGAAAGATCGTGCACGTTCGTCCTGGTATAGTGGGAAGGGGACCTGCACGAGGGAAAACGGCTGCCTCGAAGAGGCAGGGACCACGCGGGA
TGCGCCCGCGTCTGAAGCCAGACCCCCGGCTCCCCGAGGGAGAACAGGACGGAGGGCGGGGCTGTGGGGAGCGGAGGGAATGAAGGTCAGGGAGGCGGCG
GGGACCCCCTGAGCTGGCACAGGCCCCGGGAACGTCTGTGGAACAGGGGACGGGATGGGGCGTGGGGGAAGGAGGTGCGGGCTGCAGGAGCGGGGGTGAT
GGGGTCACTCACGGCGGCGGGACTGGGGGTACTGGGTGGGGGGGTCGGGTGGGGCCGGGGCTGCAGTGGAGGGTGTGGGGCGGGGAGATGCCCTCATTGC
CCGCGCACTGGCGCCCGAGCCCAGAGAAGAGAGCGCCGGCTTCCCCGCCAGTGGCCGCAGCACCCCAGGAGCGCGGGAACCTCCGGACCCACAGCGGGGC
GCGGCCGGGGCAGGTGGGGGGCCCAGGCGAGGAAGCCCCCTCTGCGCCCTGGGCTGGGCGAAGGGCCCTGCGATGCGACGGGGGCAGCCCCAGCGCGCGC
CCAGTCCTCACGTCGCCACCGAGCGGCGCCCCCGCCCCAGCCCGGAGCCCCGCAGGGCCGCCCCCACCCCTGCCCACCCTCCCGCGGGCCGGGGCAGCCC
CCCGCCAGCCACCCCGCGTTCCCAGGAAGAGGGACCGGTCATTACTCATTCATGTCCTTTCATTTCATTTCAATATTTTCTGCAAAGTCATCGCCCGCGC
CGCATCTGCGTGGCGGGGGGCGGGGTGGGGCGGAGCCACGCCGCGGAGTCGCCGCAGGTAAACAGCCCCCTCCCCGCGGCGGGAGCGGGGCCGCCGGCCC
CAGGCAGGGACAGCAGCCGCCGCCCGCGCTCCGGGCCGGGATCCCGCCGCCGCCCCCGCCGGAGGCACGCGCCAGGGCGGGGGCCGGGCTGCGGCGGAGG
CGGGCGGCTCCGGTGCCCCCCGCCGCCGCCCCGGCCCGGCCCGCCCGCCCCCTGACCCCGGGGGCGGCGGCGGAGCGCCCCCCAAACCCCGCTGCGGGCT
CCGCGCCCGGCCAGCCCCGCACCCGCCGCGCGCCTCCGGCTACTCCCATCCCCCGGAGCCCCCCGCTCGGTCCCGGCGTCCCCTGCCACCCTCTCCCGCG
GCCCGCGGCCCCGTCCCCGTCCCGCGCCCCCACGCTCCCCGATCCCCGCCCCCGCGCCGCGCGTCCCCTCCCGCCCGCGCCCCCCTCGCCGGGCCCCGCC
CCGCGCCCCCCGCCCCGCCCGCGCCCCCCGCCGGGCCGCGCCCCCCGCCCCCCATGCACCACCTCCTGGAGCAGTCGGCGGACATGGCGACCGCGCTGCT
GGCGGGAGAGAAGCTGCGGGAGCTGATCCTGCCGGGCGCGCAGGACGACAAGGCGGGCGCGCTGGCCGCGCTGCTTCTGCAGCTGAAGCTGGAGCTGCCG
TTCGACCGGGTGGTCACCATCGGCACCGTGCTGGTGCCCATCCTGCTGGTCACCCTGGTCTTCACCAAGAACTTCGCAGGTGAGGCCGGCGGCCGGGGCG
CGGGGCGCGGGCAGAGGGGGCGTCCGCAGGTGTCCGGGAGCTGGCGCTTCCCGCGTCCCCGGCGGCTCCGTCCAGCCGCGCCCACCGTGGCCTGGCTGCG
TCCGCGGCGTCCCAGGCACCTTCCACAGCCGCCCCCATCCTAGCAGGTGTCGCTGGTCGCACAGACCCCTCGTCTCTATTTTATTGTTGTTCTTCCTTCC
ATTCGTCCGCCCATGGCCGCGGGTGGGACTAGGCCTGTCTGGACCCAGGGGTCCCAAATGTCATGAGACACGGGGTCTGGTTTGGAGAATGTCACAAGCA
GCGCCTGAGGGGATGCAGGGTGGCCAGGTGGGGACCAGGAAAGGCCGGGATGGGTGTTGACAGCAGAGAGCT

We can use this tool http://www.restrictionmapper.org/ to do a virtual restriction digest; select the three restriction enzymes (use control to select more than one), and click virtual digest:

My digest

Enzymes: AccI, Hin6I, HpaII

Length  5' Enzyme  5' Base   3' Enzyme   3' Base    Sequence
223     Hin6I      1779      Hin6I       2001       CGCCCACCGT GGCCTGGCTG CGTCCGCGGC GTCCCAGGCA CCTTCCACAG
                                                    CCGCCCCCAT CCTAGCAGGT GTCGCTGGTC GCACAGACCC CTCGTCTCTA
                                                    TTTTATTGTT GTTCTTCCTT CCATTCGTCC GCCCATGGCC GCGGGTGGGA
                                                    CTAGGCCTGT CTGGACCCAG GGGTCCCAAA TGTCATGAGA CACGGGGTCT
                                                    GGTTTGGAGA ATGTCACAAG CAG
179     HpaII      24        Hin6I       202        CGGGCCTGTG AACACGGGCT CAAAATACAT TTTTGGAATG AATTATTGAA
                                                    TGAACTTAAA ACTCCAATCA CACTAAATCT TTTATATGAA AGATCGTGCA
                                                    CGTTCGTCCT GGTATAGTGG GAAGGGGACC TGCACGAGGG AAAACGGCTG
                                                    CCTCGAAGAG GCAGGGACCA CGCGGGATG
129     HpaII      327       HpaII       455        CGGGAACGTC TGTGGAACAG GGGACGGGAT GGGGCGTGGG GGAAGGAGGT
                                                    GCGGGCTGCA GGAGCGGGGG TGATGGGGTC ACTCACGGCG GCGGGACTGG
                                                    GGGTACTGGG TGGGGGGGTC GGGTGGGGC
100     HpaII      227       HpaII       326        CGGCTCCCCG AGGGAGAACA GGACGGAGGG CGGGGCTGTG GGGAGCGGAG
                                                    GGAATGAAGG TCAGGGAGGC GGCGGGGACC CCCTGAGCTG GCACAGGCCC
97      Hin6I      898       HpaII       994        CGCCGCATCT GCGTGGCGGG GGGCGGGGTG GGGCGGAGCC ACGCCGCGGA
                                                    GTCGCCGCAG GTAAACAGCC CCCTCCCCGC GGCGGGAGCG GGGCCGC
80      HpaII      1607      HpaII       1686       CGGGTGGTCA CCATCGGCAC CGTGCTGGTG CCCATCCTGC TGGTCACCCT
                                                    GGTCTTCACC AAGAACTTCG CAGGTGAGGC
62      HpaII      836       Hin6I       897        CGGTCATTAC TCATTCATGT CCTTTCATTT CATTTCAATA TTTTCTGCAA
                                                    AGTCATCGCC CG
55      Hin6I      1439      Hin6I       1493       CGCCCCCCGC CCCCCATGCA CCACCTCCTG GAGCAGTCGG CGGACATGGC
                                                    GACCG
51      HpaII      1274      Hin6I       1324       CGGCGTCCCC TGCCACCCTC TCCCGCGGCC CGCGGCCCCG TCCCCGTCCC
                                                    G
51      Hin6I      645       Hin6I       695        CGCCCTGGGC TGGGCGAAGG GCCCTGCGAT GCGACGGGGG CAGCCCCAGC
                                                    G
49      Hin6I      645       Hin6I       693        CGCCCTGGGC TGGGCGAAGG GCCCTGCGAT GCGACGGGGG CAGCCCCAG
48      HpaII      456       Hin6I       503        CGGGGCTGCA GTGGAGGGTG TGGGGCGGGG AGATGCCCTC ATTGCCCG
47      HpaII      743       HpaII       789        CGGAGCCCCG CAGGGCCGCC CCCACCCCTG CCCACCCTCC CGCGGGC
46      HpaII      790       HpaII       835        CGGGGCAGCC CCCCGCCAGC CACCCCGCGT TCCCAGGAAG AGGGAC
44      Hin6I      2002      HpaII       2045       CGCCTGAGGG GATGCAGGGT GGCCAGGTGG GGACCAGGAA AGGC
39      HpaII      606       Hin6I       644        CGGGGCAGGT GGGGGGCCCA GGCGAGGAAG CCCCCTCTG
39      Hin6I      1494      HpaII       1532       CGCTGCTGGC GGGAGAGAAG CTGCGGGAGC TGATCCTGC
38      Hin6I      1569      HpaII       1606       CGCTGCTTCT GCAGCTGAAG CTGGAGCTGC CGTTCGAC
35      HpaII      537       Hin6I       571        CGGCTTCCCC GCCAGTGGCC GCAGCACCCC AGGAG
32      HpaII      995       Hin6I       1026       CGGCCCCAGG CAGGGACAGC AGCCGCCGCC CG
30      Hin6I      1325      Hin6I       1354       CGCCCCCACG CTCCCCGATC CCCGCCCCCG
29      Hin6I      698       Hin6I       726        CGCCCAGTCC TCACGTCGCC ACCGAGCGG
29      Hin6I      1706      HpaII       1734       CGCGGGCAGA GGGGGCGTCC GCAGGTGTC
28      Hin6I      1176      Hin6I       1203       CGCCCCCCAA ACCCCGCTGC GGGCTCCG
27      HpaII      2046      none        2072       CGGGATGGGT GTTGACAGCA GAGAGCT
26      HpaII      1085      HpaII       1110       CGGGCTGCGG CGGAGGCGGG CGGCTC
24      Hin6I      203       HpaII       226        CGCCCGCGTC TGAAGCCAGA CCCC
23      none       1         HpaII       23         CCTGGTTTGC TCACAGCAGT GGC
23      HpaII      1037      HpaII       1059       CGGGATCCCG CCGCCGCCCC CGC
23      HpaII      1208      Hin6I       1230       CGGCCAGCCC CGCACCCGCC GCG
22      Hin6I      512       Hin6I       533        CGCCCGAGCC CAGAGAAGAG AG
22      HpaII      1137      HpaII       1158       CGGCCCGCCC GCCCCCTGAC CC
21      HpaII      1111      HpaII       1131       CGGTGCCCCC CGCCGCCGCC C
21      HpaII      1208      Hin6I       1228       CGGCCAGCCC CGCACCCGCC G
21      Hin6I      1539      Hin6I       1559       CGCAGGACGA CAAGGCGGGC G
20      HpaII      1254      HpaII       1273       CGGAGCCCCC CGCTCGGTCC
19      Hin6I      1539      Hin6I       1557       CGCAGGACGA CAAGGCGGG
19      HpaII      1760      Hin6I       1778       CGGCGGCTCC GTCCAGCCG
18      Hin6I      1360      Hin6I       1377       CGCGTCCCCT CCCGCCCG
18      Hin6I      1404      Hin6I       1421       CGCCCCCCGC CCCGCCCG
17      HpaII      1159      Hin6I       1175       CGGGGGCGGC GGCGGAG
17      HpaII      1237      HpaII       1253       CGGCTACTCC CATCCCC
16      HpaII      584       Hin6I       599        CGGACCCACA GCGGGG
16      Hin6I      727       HpaII       742        CGCCCCCGCC CCAGCC
15      Hin6I      1070      HpaII       1084       CGCCAGGGCG GGGGC
15      Hin6I      1745      HpaII       1759       CGCTTCCCGC GTCCC
14      HpaII      1390      Hin6I       1403       CGGGCCCCGC CCCG
12      Hin6I      572       HpaII       583        CGCGGGAACC TC
12      Hin6I      1378      HpaII       1389       CGCCCCCCTC GC
10      HpaII      1060      Hin6I       1069       CGGAGGCACG
10      Hin6I      1422      HpaII       1431       CGCCCCCCGC
10      HpaII      1735      Hin6I       1744       CGGGAGCTGG
9       Hin6I      1560      Hin6I       1568       CGCTGGCCG
8       Hin6I      504       Hin6I       511        CGCACTGG
7       HpaII      1432      Hin6I       1438       CGGGCCG
7       HpaII      1687      HpaII       1693       CGGCGGC
7       Hin6I      1699      Hin6I       1705       CGCGGGG
6       Hin6I      600       HpaII       605        CGCGGC
6       Hin6I      1231      HpaII       1236       CGCCTC
6       HpaII      1533      Hin6I       1538       CGGGCG
5       Hin6I      1027      HpaII       1031       CGCTC
5       HpaII      1032      HpaII       1036       CGGGC
5       HpaII      1132      HpaII       1136       CGGCC
5       Hin6I      1355      Hin6I       1359       CGCCG
5       HpaII      1694      Hin6I       1698       CGGGG
4       Hin6I      1204      HpaII       1207       CGCC
4       HpaII      1533      Hin6I       1536       CGGG
4       Hin6I      694       Hin6I       697        CGCG
3       Hin6I      534       HpaII       536        CGC
2       Hin6I      694       Hin6I       695        CG
2       Hin6I      696       Hin6I       697        CG
2       Hin6I      1229      Hin6I       1230       CG
2       Hin6I      1537      Hin6I       1538       CG
2       Hin6I      1558      Hin6I       1559       CG

There are many fragments in the restriction digestion, which are reflected in the sequenced reads.