Loading...
 

SAMTools

NOTE: this page is now available at https://github.com/davetang/learning_bam_file

SAMTools provides various tools for manipulating alignments in the SAM/BAM format. The SAM (Sequence Alignment/Map) format (BAM is just the binary form of SAM) is currently the de facto standard for storing large nucleotide sequence alignments. If you are dealing with high-throughput sequencing data, at some point you will probably have to deal with SAM/BAM files, so familiarise yourself with them!

Here are some basic commands to get your started. For more information on the SAM/BAM format see this page.

Basic usage

samtools
samtools <command> [options]


If you run samtools on the terminal without any parameters, all the available utilities are listed:

samtools
Program: samtools (Tools for alignments in the SAM format) Version: 0.1.18 (r982:295) Usage: samtools <command> [options] Command: view SAM<->BAM conversion sort sort alignment file mpileup multi-way pileup depth compute the depth faidx index/extract FASTA tview text alignment viewer index index alignment idxstats BAM index stats (r595 or later) fixmate fix mate information flagstat simple stats calmd recalculate MD/NM tags and '=' bases merge merge sorted alignments rmdup remove PCR duplicates reheader replace BAM header cat concatenate BAMs targetcut cut fosmid regions (for fosmid pool only) phase phase heterozygotes


Most of the times I just use view, sort, index and flagstats.

Converting a SAM file to a BAM file


A BAM file is just a SAM file but stored in binary; you should always convert your SAM files into BAM to save storage space and BAM files are faster to manipulate.

To get started, view the first couple of lines of your SAM file by typing on the terminal:

shell
head test.sam


The first 10 lines on your terminal after typing "head test.sam", should be lines starting with the "@" sign, which is an indicator for a header line. If you don't see lines starting with the "@" sign, the header information is most likely missing.

If the header is absent from the SAM file use the command below, where reference.fa is the reference fasta file used to map the reads:

samtools
samtools view -bT reference.fa test.sam > test.bam


If the header information is available:

samtools
samtools view -bS test.sam > test.bam

Sorting a BAM file


Always sort your BAM files; many downstream programs only take sorted BAM files.

samtools
samtools sort test.bam test_sorted

Converting SAM directly to a sorted BAM file


Like many Unix tools, SAMTools is able to read directly from a stream i.e. stdout.

samtools
samtools view -bS file.sam | samtools sort - file_sorted

Creating a BAM index file


A BAM index file is usually needed when visualising a BAM file.

samtools
samtools index test_sorted.bam test_sorted.bai

Converting a BAM file to a SAM file


Note: remember to use -h to ensure the converted SAM file contains the header information. Generally, I recommend storing only sorted BAM files as they use much less disk space and are faster to process.

samtools
samtools view -h NA06984.chrom16.ILLUMINA.bwa.CEU.low_coverage.20100517.bam > NA06984.chrom16.ILLUMINA.bwa.CEU.low_coverage.20100517.sam

Filtering out unmapped reads in BAM files

samtools
samtools view -h -F 4 blah.bam > blah_only_mapped.sam OR samtools view -h -F 4 -b blah.bam > blah_only_mapped.bam

Extracting SAM entries mapping to a specific loci


If we want all reads mapping within the genomic coordinates chr1:200000-500000:

samtools
#index the bam file first samtools index test.bam samtools view test.bam chr1:200000-500000 #all reads mapping on chr1 as another bam samtools view -b test.bam chr1 > test_chr1.bam

Extracting only the first read from paired end BAM files


Sometimes you only want the first pair of a mate

samtools
samtools view -h -f 0x0040 test.bam > test_first_pair.sam


0x0040 is hexadecimal for 64 (i.e. 16 * 4), which is binary for 1000000, corresponding to the read in the first read pair.

Simple stats using SAMTools flagstat


The flagstat command provides simple statistics on a BAM file. Here I downloaded a BAM file from the 1000 genome project: ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data/NA06984/alignment/NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam

Then simply:

samtools flagstat
samtools flagstat NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam


16874858 + 0 in total (QC-passed reads + QC-failed reads)
290281 + 0 duplicates
36683299 + 0 mapped (97.21%)
46816083 + 0 paired in sequencing
53408650 + 0 read1
63407433 + 0 read2
76348470 + 0 properly paired (93.14No value assigned)
86432965 + 0 with itself and mate mapped
9191559 + 0 singletons (2.81No value assigned)
1057057 + 0 with mate mapped to a different chr
1145762 + 0 with mate mapped to a different chr (mapQ>=5)


To confirm some of the numbers returned by flagstat:

flagstat
samtools view NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam | wc 6874858 #same as line 1 samtools view -F 4 NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam | wc 6683299 #same as line 3 samtools view -f 0x0040 NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam | wc 3408650 #same as line 5 samtools view -f 0x0080 NA06984.chrom20.ILLUMINA.bwa.CEU.low_coverage.20111114.bam | wc 3407433 #same as line 6 and so on...


Here's an example of a properly paired read:

SRR035024.17204235 163 20 60126 60 68M8S = 60466 383 CCACCATGGACCTCTGGGATCCTAGCTTTAAGAGATCCCATCACCCACATGAACGTTTGAATTGACAGGGGGAGCG @FEBBABEEDDGIGJIIIHIHJKHIIKAEHKEHEHI>JIJBDJHIJJ5CIFH4;;9=CDB8F8F>5B######### X0:i:1 X1:i:0 XC:i:68 MD:Z:68 RG:Z:SRR035024 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:BH@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
SRR035024.17204235 83 20 60466 60 32S44M = 60126 -383 GGCCTCCCCCCGGGCCCCTCTTGTGTGCACACAGCACAGCCTCTACTGCTACACCTGAGTACTTTGCCAGTGGCCT #################################>D:LIJEJBJIFJJJJIHKIJJJIKHIHIKJJIJJKGIIFEDB X0:i:1 X1:i:0 XC:i:44 MD:Z:44 RG:Z:SRR035024 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@


For more statistics of SAM/BAM files see the SAMStat program.

See the section "Interpreting the BAM flags" below for more information on BAM flags.

Interpreting the BAM flags


The second column in a SAM/BAM file is the flag column. They may seem confusing at first but the encoding allows details about a read to be stored by just using a few digits. The trick is to convert the numerical digit into binary, and then use the table to interpret the binary numbers, where 1 = true and 0 = false.

I wrote an entire post on my blog regarding this: http://davetang.org/muse/2014/03/06/understanding-bam-flags/, which also includes a Perl script for interpreting BAM flags.

SAMTools calmd/fillmd


The calmd or fillmd tool is useful for visualising mismatches and insertions in an alignment of a read to a reference genome. For example:

fillmd
#random BAM file mapped with BWA samtools view blah.bam blah 0 chr1 948827 37 1M2D17M1I8M * 0 0 GGTGTGTGCCTCAGGCTTAATAATAGG ggcgde`a`egfbfgghdfa_cfea^_ XT:A:U NM:i:3 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:1^AC25 #the -e changes identical bases between the read and reference into ='s samtools view -b blah.bam | samtools fillmd -e - ref.fa blah 0 chr1 948827 37 1M2D17M1I8M * 0 0 ==================A======== ggcgde`a`egfbfgghdfa_cfea^_ XT:A:U NM:i:3 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:1^AC25 The original read sequence is: blah G--GTGTGTGCCTCAGGCTTAATAATAGG | |||||||||||||||||| ||||||| genome GACGTGTGTGCCTCAGGCTTA-TAATAGG The CIGAR string (1M2D17M1I8M) is shown with respect to the read, i.e. a deletion means a deletion in the read and an insertion is an insertion in the read, as you can see above. SAMTools fillmd shows the insertions (as above) and mismatches (not in the example above) but not deletions.

Creating FASTQ files from a BAM file


I found this great tool at http://www.hudsonalpha.org/gsl/software/bam2fastq.php

For example to extract ONLY unaligned from a bam file:

samtools
bam2fastq -o blah_unaligned.fastq --no-aligned blah.bam


To extract ONLY aligned reads from a bam file:

samtools
bam2fastq -o blah_aligned.fastq --no-unaligned blah.bam

Random subsampling of BAM file


The SAMTools view -s parameter allows you to randomly sample lines of a BAM file

samtools view -s 0.5 -b file.bam > random_half_of_file.bam

Note that this will subsample half of the reads that mapped.

Fastest way to count number of reads


From http://left.subtree.org/2012/04/13/counting-the-number-of-reads-in-a-bam-file/#comment-403

count
#number of reads samtools idxstats in.bam | awk '{s+=$3+$4} END {print s}' #number of mapped reads samtools idxstats in.bam | awk '{s+=$3} END {print s}'

Obtaining genomic sequence

genomic_seq
# some test fasta cat test.fa >chr1 AAAAAAAAAA CCCCCCCCCC GGGGGGGGGG TTTTTTTTTT # index fasta file samtools faidx test.fa # obtain sequence samtools faidx test.fa chr1:10-11 >chr1:10-11 AC # note the 1-based start samtools faidx test.fa chr1:20-31 >chr1:20-31 CGGGGGGGGGGT

More information


http://samtools.sourceforge.net/

http://sourceforge.net/apps/mediawiki/samtools/index.php?title=SAM_FAQ