RNAfold

RNAfold is a program that calculates secondary structures of RNAs. RNAfold reads RNA sequences from stdin, calculates their minimum free energy (mfe) structure and prints to stdout the mfe structure in bracket notation and its free energy. My understanding is that the lowest energy structure i.e. minimum free energy, is the most thermodynamical stable one. Here I use the RNAfold web server to calculate the secondary structure of a pre-miRNA.

From miRBase, download hairpin.fa and use let-7a-1 as an example:

>hsa-let-7a-1 MI0000060 Homo sapiens let-7a-1 stem-loop
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACC
CACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Input the sequence in the RNAfold web server:

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -36.10 kcal/mol is given below.
 [color by base-pairing probability | color by positional entropy | no coloring]
1      UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
1      (((((.(((..((((((((((((((((...(((.....))).((....))....))))))))))))))))..))))))))

I took the 80bp sequence and randomised it 5 times and used these random sequences as input to RNAfold to compare minimum free energies:

>random1
AACGGUACUAUUCAAUUUGGCGCUUCGGUAUAACGUAAAA
UCCUAUAUGGUUCGUUUCCUCAGAGGGAAUGUUCGACGGA

Minimum free energy of -13.40 kcal/mol

>random2
UAUGCGAGGGGUUGGGUAAUGUAGCACCACAACCGUAUCU
AUCGUAAUGCUUAUAUGUAAACUUUUAGGUUCGCUGCACA

Minimum free energy of -18.00 kcal/mol

>random3
CUAUCUGCUUAUAUAUGAAAUCGGGUUCCGCCAUCCCAAA
ACAAAGCUUGACUGCUGGGGAUUAAUGUUGUUGGUAGUGA

Minimum free energy of -15.60 kcal/mol

>random4
AAACCCAAGGCAAUCGUUACAGUCGGUGUUUGAUUGAAUG
UGAAGAGAACGCUUCCCGUUACCGCUAUUUGGGUUUAAUU

Minimum free energy of -21.90 kcal/mol

>random5
AUCUGCCACGUACCUGACCUAGAAUUAUCUUGAGUUUGAG
UCUUACACUGGGGACAGGAUAUGAUUAAGCAGUUCUAGGU

Minimum free energy of -21.41 kcal/mol

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -37.53 kcal/mol.
The frequency of the MFE structure in the ensemble is 9.86 %.
The ensemble diversity is 5.89 .

Pre-miRNAs are processed by Dicer into the mature miRNAs creating two overhangs. The corresponding mature miRNAs are also available at miRBase.

>hsa-let-7a-5p MIMAT0000062 Homo sapiens let-7a-5p
UGAGGUAGUAGGUUGUAUAGUU
>hsa-let-7a-3p MIMAT0004481 Homo sapiens let-7a-3p
CUAUACAAUCUACUGUCUUUC
>hsa-let-7a-2-3p MIMAT0010195 Homo sapiens let-7a-2-3p
CUGUACAGCCUCCUAGCUUUCC

Below I align the 5′ and 3′ mature let-7a-1 miRNAs back to the pre-miRNA, also including the secondary structure prediction and delimiting the miRNA boundaries:

hairpin         UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
1               (((((.(((..((((((((((((((((...(((.....))).((....))....))))))))))))))))..))))))))
mirna           -----UGAGGUAGUAGGUUGUAUAGUU-----------------------------CUAUACAAUCUACUGUCUUUC---
                     **********************                             *********************
                   |                                                                        |
                   --------------------------------------------------------------------------
                                          |                           |
                                          -----------------------------

And finally in graphical form with the 5′ and 3′ mature miRNAs:

Print Friendly, PDF & Email



Creative Commons License
This work is licensed under a Creative Commons
Attribution 4.0 International License
.
4 comments Add yours
        1. Oh right. Yeah I took the same approach as the person who made the figure in your question; I manually drew the mature miRNAs.

Leave a Reply

Your email address will not be published. Required fields are marked *

This site uses Akismet to reduce spam. Learn how your comment data is processed.