Bowtie and multimapping reads

Updated 2014 June 8th

I first tried this with BWA. Now I'll try it with Bowtie.

git clone
cd bowtie

Consider this reference sequence, which is the sequence "ACGTACGTACGTACGTAGGTACGTAGGG" repeated 20 times:


and this read:


The next steps are to build an index and then align our read to the index:

#build index
bowtie-build ref.fa ref

#if you want to scroll up and down the usage
#bowtie 2>&1 | less
#here are what the parameters mean
#-k <int>           report up to <int> good alignments per read (default: 1)
#-f                 query input files are (multi-)FASTA .fa/.mfa
#-S/--sam           write hits in SAM format
bowtie -k 40 -f -S ref read.fa
@HD	VN:1.0	SO:unsorted
@SQ	SN:artificial	LN:560
@PG	ID:Bowtie	VN:1.0.1	CL:"bowtie -k 40 -f -S ref read.fa"
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 39 alignments to 1 output stream(s)

To report all the best alignments:

bowtie -f -a -S --best --strata ref read.fa
@HD	VN:1.0	SO:unsorted
@SQ	SN:artificial	LN:560
@PG	ID:Bowtie	VN:1.0.1	CL:"bowtie -f -a -S --best --strata ref read.fa"
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 20 alignments to 1 output stream(s)

If I want to exclude tags mapping to m places:

bowtie -f -a -m 19 -S --best --strata ref read.fa
@HD	VN:1.0	SO:unsorted
@SQ	SN:artificial	LN:560
@PG	ID:Bowtie	VN:1.0.1	CL:"bowtie -f -a -m 19 -S --best --strata ref read.fa"
# reads processed: 1
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments

I could not find an option for reporting all alignments in BWA (which may exist?); the default behaviour for BWA is to report one random location for multimapping tags. Using the -a -m 10 -S --best --strata parameters, does exactly what I want; report all alignments but keep only the best hits, however if a tag maps to more than 10 places mark it as unmapped.

See the Bowtie manual for more information and usage examples.

Print Friendly, PDF & Email

Creative Commons License
This work is licensed under a Creative Commons
Attribution 4.0 International License
One comment Add yours

Leave a Reply

Your email address will not be published. Required fields are marked *