Bowtie and multimapping reads

Updated 2014 June 8th I first tried this with BWA. Now I'll try it with Bowtie. Consider this reference sequence, which is the sequence "ACGTACGTACGTACGTAGGTACGTAGGG" repeated 20 times: >artificial ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG ACGTACGTACGTACGTAGGTACGTAGGG and this read: >tag ACGTACGTACGTACGTAGGTACGTA The...

Continue Reading